diff - Perl while loops and reading lines -


each record has 4 lines:

like following:

@ncyc361­11a03.q1k bases 1 to 1576 gcgtgcccgaaaaaatgcttttggagccgcgcgtgaaat + !)))))****(((***%%((((*(((+,**(((+**+,­ 

there 2 files in 1 file corresponded other

there array of seqeunces a1 read 1 record @ time file 1. read record file 2. if sequence in record 1 file 1 (line 2) matches seuqnece in array a1, print record file 2 output file on...but point need read record @ time.... how break out of inner loop can read next record file 1 , compare next record in file 2

if ask controlling nested loops can labels.

example:

outer: while(<>){     for(@something){         last outer;     } } 

see last example.


Comments

Popular posts from this blog

jquery - Invalid Assignment Left-Hand Side -

java - Play! framework 2.0: How to display multiple image? -

gmail - Is there any documentation for read-only access to the Google Contacts API? -