diff - Perl while loops and reading lines -


each record has 4 lines:

like following: 

@ncyc361­11a03.q1k bases 1 to 1576 gcgtgcccgaaaaaatgcttttggagccgcgcgtgaaat + !)))))****(((***%%((((*(((+,**(((+**+,­

there 2 files in 1 file corresponded other

there array of seqeunces a1 read 1 record @ time file 1. read record file 2. if sequence in record 1 file 1 (line 2) matches seuqnece in array a1, print record file 2 output file on...but point need read record @ time.... how break out of inner loop can read next record file 1 , compare next record in file 2

if ask controlling nested loops can labels.

example:

outer: while(<>){     for(@something){         last outer;     } }

see last example.


Comments

Post a Comment

Popular posts from this blog

java - Play! framework 2.0: How to display multiple image? -

i need display gallery of photos. here template: @(photos: list[photo]) @title = { <bold>gallery</bold> } @main(title,"photo"){ <ul class="thumbnails"> @for(photo <- photos) { <li class="span3"> <a href="#" class="thumbnail"> <img src="@photo.path" alt=""> </a> </li> } </ul> } and here controller method: public static result getphotos() { return ok(views.html.photo.gallery.render(photo.get())); } and here photo bean : @entity public class photo extends model { @id public long id; @required public string label; public string path; public photo(string path, string label) { this.path = path; this.label = label; } private static finder<long, photo> find = new finder<long, photo>( long.class, photo.class); public static list<phot...
Read more

gmail - Is there any documentation for read-only access to the Google Contacts API? -

i want read-only access user's google contacts. there stackoverflow member wanted this, , received following answer : yes, there is, use https://www.googleapis.com/auth/contacts.readonly scope , "view contacts". this exchange reference read-only access google contacts can find using google. simply using access token obtained attempt read usual google contacts api (i.e. https://www.google.com/m8/feeds ) fails insufficient permissions. similarly, using google contacts api on new target fails 404 errors (for example https://www.googleapis.com/auth/contacts.readonly/default/full ). is there documentation anywhere on how use api, or permissible way access google contacts api full read-write access?
Read more

php - Controller/JToolBar not working in Joomla 2.5 -

relevant code: jtoolbarhelper::custom('savecategories', 'save', '', 'save', false, false); ... <input type="hidden" name="controller" value="easyblogcontroller"> according can dig docs , own previous questions, should call savecategories() function in easyblogcontroller . i've tried setting value easyblog , easyblog.php (file name) current easyblogcontroller (class name). clicking on save button refreshes page. not redirect, echo or var_dump test code put in savecategories() function. var_dump ing jrequest::getvar('controller') , 'task' return correct values. creating controller object , using $controller->execute('task'); works. the values going depend on location of controller trying call, , have couple options here. typically there controller in base folder of component (likely components/com_easyblog) in file called controller.php , class name inside ...
Read more