python - how to : multiline to oneline by removing newlines -


i'm newbie in python starting learn it.

i wanted make script count same letter pattern in text file. problem text file has multiple lines. couldn't find of patterns went on next line.

my file , pattern dna sequence.

example:

'attctcgatcagtctctctagtgtgtgagagactctagctagatcgtccactcactgac**ga  tc**agtcagt**gatc**tctcctactacaaggtgacatgagtgtaaattagtgtgagtgagtgaa' 

i'm looking 'gatc'. second 1 counted, first wasn't.

so, how can make file 1 line text file?

you can join lines when read pattern file:

    fd = open('dna.txt', 'r')     dnatext = ''.join(fd.readlines())     dnatext.count('gatc') 

Comments

Popular posts from this blog

jquery - Invalid Assignment Left-Hand Side -

javascript - Preserving URL fragment through CAS sign-on -

asp.net mvc - Implementing normal user/pass, Twitter & Facebook auth -